| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 494324 |
Name | MIR375 |
Synonym | MIRN375|hsa-mir-375|miRNA375;microRNA 375;MIR375;microRNA 375 |
Definition | - |
Position | 2q35 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 494324 |
Links to all GeneRIF Items | 494324 |
Links to iHOP | 494324 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >494324 : length: 22 tttgttcgttcggctcgcgtga |
Protein Sequence | >494324 : length: 3 N/A |