| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 494332 |
Name | MIR383 |
Synonym | MIRN383|hsa-mir-383;microRNA 383;MIR383;microRNA 383 |
Definition | - |
Position | 8p22 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 494332 |
Links to all GeneRIF Items | 494332 |
Links to iHOP | 494332 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >494332 : length: 22 agatcagaaggtgattgtggct |
Protein Sequence | >494332 : length: 3 N/A |