| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 574413 |
Name | MIR409 |
Synonym | MIRN409|hsa-mir-409;microRNA 409;MIR409;microRNA 409 |
Definition | - |
Position | 14q32.31 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 574413 |
Links to all GeneRIF Items | 574413 |
Links to iHOP | 574413 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >574413 : length: 23 aggttacccgagcaactttgcat |
Protein Sequence | >574413 : length: 3 N/A |