| General information | Literature | Expression | Regulation | Variant | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 574443 |
Name | MIR490 |
Synonym | MIRN490|hsa-mir-490|miR-490;microRNA 490;MIR490;microRNA 490 |
Definition | - |
Position | 7q33 |
Gene Type | ncRNA |
|
TSG scores |
Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
|
External Links |
|
Links to Entrez Gene | 574443 |
Links to all GeneRIF Items | 574443 |
Links to iHOP | 574443 |
|
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>574443 : length: 20 ccatggatctccaggtgggt |
Protein Sequence |
>574443 : length: 3 N/A |