| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 619554 |
Name | MIR486-1 |
Synonym | MIR486|MIRN486|hsa-mir-486|hsa-mir-486-1;microRNA 486-1;MIR486-1;microRNA 486-1 |
Definition | microRNA 486 |
Position | 8p11.21 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 619554 |
Links to all GeneRIF Items | 619554 |
Links to iHOP | 619554 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >619554 : length: 22 tcctgtactgagctgccccgag |
Protein Sequence | >619554 : length: 3 N/A |