General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 693123 |
Name | MIR449B |
Synonym | MIRN449B;microRNA 449b;MIR449B;microRNA 449b |
Definition | hsa-mir-449b |
Position | 5q11.2 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 693123 |
Links to all GeneRIF Items | 693123 |
Links to iHOP | 693123 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>693123 : length: 22 aggcagtgtattgttagctggc |
Protein Sequence |
>693123 : length: 3 N/A |