General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information |
|
---|---|
Gene ID | 693135 |
Name | MIR551A |
Synonym | MIRN551A;microRNA 551a;MIR551A;microRNA 551a |
Definition | hsa-mir-551a |
Position | 1p36.32 |
Gene Type | ncRNA |
TSG scores |
Description |
TUSON ranking | N/A |
TUSON P-value | N/A |
External Links |
|
Links to Entrez Gene | 693135 |
Links to all GeneRIF Items | 693135 |
Links to iHOP | 693135 |
Sequence Information |
The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence |
>693135 : length: 21 gcgacccactcttggtttcca |
Protein Sequence |
>693135 : length: 3 N/A |