| General information | Literature | Expression | Regulation | Variant | Interaction |
Basic Information | |
|---|---|
Gene ID | 693200 |
Name | MIR615 |
Synonym | MIRN615|hsa-mir-615;microRNA 615;MIR615;microRNA 615 |
Definition | - |
Position | 12q13.13 |
Gene Type | ncRNA |
TSG scores | Description |
| TUSON ranking | N/A |
TUSON P-value | N/A |
External Links | |
Links to Entrez Gene | 693200 |
Links to all GeneRIF Items | 693200 |
Links to iHOP | 693200 |
Sequence Information | The sequences provided here are only the longest representative sequences, not covering all the isoforms. |
Nucleotide Sequence | >693200 : length: 22 gggggtccccggtgctcggatc |
Protein Sequence | >693200 : length: 3 N/A |