|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 100302232 |
Name | MIR1226 |
Synonym | MIRN1226|hsa-mir-1226;microRNA 1226;MIR1226;microRNA 1226 |
Definition | - |
Position | 3p21.31 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | MIR-1226 functions as a tumor suppressor by promoting the induction of cell death. |
| More detail of all 1 literatures about MIR1226 | |
|
External Links |
|
Links to Entrez Gene | 100302232 |
Links to all GeneRIF Items | 100302232 |
Links to iHOP | 100302232 |
|
Sequence Information |
|
Nucleotide Sequence |
>100302232 : length: 26 gtgagggcatgcaggcctggatgggg |