|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 347745 |
Name | PAR4 |
Synonym | -;Prader-Willi/Angelman region gene 4;-;- |
Definition | - |
Position | 15q11.2 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
Evidence Status | Description |
potential | "Results suggest that, in breast cancer, Par-4 plays a similar tumor suppressor gene role as reported in endometrial carcinoma, and that Par-4 expression has a significant inverse association with expression of progesterone receptor." |
| More detail of all 1 literatures about PAR4 | |
External Links | |
Links to Entrez Gene | 347745 |
Links to all GeneRIF Items | 347745 |
Links to iHOP | 347745 |
Sequence Information | |
Nucleotide Sequence | >347745 : length: 342 gaagctcaggcccttcctggccccttgatctcctgcactgagctgtggtgagcacatccg ggtcccgctggatgtatgtgtgggcagggggggtgccctgggttgggtcaatgatgagaa ccctatattgtgttgaagagaggtgatgacttaaaattaccatgctcaatgattacgctg aggcccaacctaggtgagaaatttggaggaggatgctgggatcccgagatttccggcagg gccactgtattttgggctggagccctggaggccctgaaaggtatctggaggaggcccaac tctgtctctgcactcctctgtgaggcagcccaggctccctgt |