Entrez Gene

Basic Information
Gene ID	406881
Name	MIRLET7A1
Synonym	LET7A1\|MIRNLET7A1\|let-7a-1;microRNA let-7a-1;MIRLET7A1;microRNA let-7a-1
Definition	-
Position	9q22.32
Gene Type	miscRNA
Source	Count: 2; Pubmed_search,Generif
Literature support	Count: 6 PubMed records as below.
Evidence Status	Description
reviewed	Hsa-let-7a functions as a tumor suppressor in renal cell carcinoma cell lines by targeting c-myc.
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
potential	Epigenetic down-regulation of the tumor suppressor gene PRDM1/Blimp-1 in diffuse large B cell lymphomas: a potential role of the microRNA let-7.
potential	"Data show that loss of let-7 function enhances lung tumor formation in vivo, strongly supporting the hypothesis that let-7 is a tumor suppressor."
potential	Let-7a microRNA functions as a potential tumor suppressor in human laryngeal cancer.
reviewed	The tumor suppressor microRNA let-7 represses the HMGA2 oncogene.
	More detail of all 6 literatures about MIRLET7A1
External Links
Links to Entrez Gene	406881
Links to all GeneRIF Items	406881
Links to iHOP	406881
Sequence Information
Nucleotide Sequence	>406881 : length: 22 tgaggtagtaggttgtatagtt