Entrez Gene

Basic Information
Gene ID	406887
Name	MIRLET7E
Synonym	MIRNLET7E\|hsa-let-7e\|let-7e;microRNA let-7e;MIRLET7E;microRNA let-7e
Definition	-
Position	19q13.41
Gene Type	miscRNA
Source	Count: 2; Pubmed_search,Generif
Literature support	Count: 3 PubMed records as below.
Evidence Status	Description
reviewed	JARID1B demethylase contributes to tumor cell proliferation through the epigenetic repression of a tumor suppressor miR.
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	The tumor suppressor microRNA let-7 represses the HMGA2 oncogene.
	More detail of all 3 literatures about MIRLET7E
External Links
Links to Entrez Gene	406887
Links to all GeneRIF Items	406887
Links to iHOP	406887
Sequence Information
Nucleotide Sequence	>406887 : length: 22 tgaggtaggaggttgtatagtt