Entrez Gene

Basic Information
Gene ID	406890
Name	MIRLET7G
Synonym	LET7G\|MIRNLET7G\|hsa-let-7g;microRNA let-7g;MIRLET7G;microRNA let-7g
Definition	-
Position	3p21.1
Gene Type	miscRNA
Source	Count: 1; Generif
Literature support	Count: 2 PubMed records as below.
Evidence Status	Description
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
potential	"hsa-let-7g may act as a tumor suppressor gene that inhibits HCC cell proliferation by downregulating the oncogene, c-Myc, and upregulating the tumor suppressor gene, p16(INK4A) ."
	More detail of all 2 literatures about MIRLET7G
External Links
Links to Entrez Gene	406890
Links to all GeneRIF Items	406890
Links to iHOP	406890
Sequence Information
Nucleotide Sequence	>406890 : length: 22 tgaggtagtagtttgtacagtt