Entrez Gene

Basic Information
Gene ID	406906
Name	MIR122
Synonym	MIR122A\|MIRN122\|MIRN122A\|hsa-mir-122\|miRNA122\|miRNA122A;microRNA 122;MIR122;microRNA 122
Definition	-
Position	18q21.31
Gene Type	miscRNA
Source	Count: 2; Pubmed_search,Generif
Literature support	Count: 3 PubMed records as below.
Evidence Status	Description
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	MicroRNA-122a functions as a novel tumor suppressor downstream of adenomatous polyposis coli in gastrointestinal cancers.
reviewed	"miR-122, a tumor suppressor microRNA affecting hepatocellular carcinoma intrahepatic metastasis by angiogenesis suppression, exerts some of its action via regulation of ADAM17."
	More detail of all 3 literatures about MIR122
External Links
Links to Entrez Gene	406906
Links to all GeneRIF Items	406906
Links to iHOP	406906
Sequence Information
Nucleotide Sequence	>406906 : length: 22 tggagtgtgacaatggtgtttg