|
||
|
||
General information | Expression | Regulation | Mutation | Interaction |
Basic Information |
|
---|---|
Gene ID | 406908 |
Name | MIR124-2 |
Synonym | MIRN124-2|MIRN124A2;microRNA 124-2;MIR124-2;microRNA 124-2 |
Definition | - |
Position | 8q12.3 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
Evidence Status |
Description |
potential | "This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets." |
More detail of all 1 literatures about MIR124-2 | |
External Links |
|
Links to Entrez Gene | 406908 |
Links to all GeneRIF Items | 406908 |
Links to iHOP | 406908 |
Sequence Information |
|
Nucleotide Sequence |
>406908 : length: 22 cgtgttcacagcggaccttgat |
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |