|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406911 |
Name | MIR125B1 |
Synonym | MIRN125B1;microRNA 125b-1;MIR125B1;microRNA 125b-1 |
Definition | - |
Position | 11q24.1 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 2 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | miR-125b is methylated and functions as a tumor suppressor by regulating the ETS1 proto-oncogene in human invasive breast cancer. |
potential | "This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets." |
| More detail of all 2 literatures about MIR125B1 | |
|
External Links |
|
Links to Entrez Gene | 406911 |
Links to all GeneRIF Items | 406911 |
Links to iHOP | 406911 |
|
Sequence Information |
|
Nucleotide Sequence |
>406911 : length: 22 tccctgagaccctaacttgtga |