|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 406913 |
Name | MIR126 |
Synonym | MIRN126|miRNA126;microRNA 126;MIR126;microRNA 126 |
Definition | - |
Position | 9q34.3 |
Gene Type | miscRNA |
Source | Count: 2; Pubmed_search,Generif |
Literature support | Count: 2 PubMed records as below. |
Evidence Status | Description |
potential | "This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets." |
reviewed | Epigenetic therapy upregulates the tumor suppressor microRNA-126 and its host gene EGFL7 in human cancer cells. |
| More detail of all 2 literatures about MIR126 | |
External Links | |
Links to Entrez Gene | 406913 |
Links to all GeneRIF Items | 406913 |
Links to iHOP | 406913 |
Sequence Information | |
Nucleotide Sequence | >406913 : length: 21 cattattacttttggtacgcg |
|
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |