|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406928 |
Name | MIR137 |
Synonym | MIRN137;microRNA 137;MIR137;microRNA 137 |
Definition | - |
Position | 1p21.3 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 2 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | miR-137 functionas as a tumor suppressor by targeting CtBP1 to inhibit epithelial-mesenchymal transition and inducing apoptosis of melanoma cells. |
reviewed | The results showed that miR-137 can act as a tumor suppressor in uveal melanoma cell proliferation through downregulation of the targets MITF and CDK6. |
| More detail of all 2 literatures about MIR137 | |
|
External Links |
|
Links to Entrez Gene | 406928 |
Links to all GeneRIF Items | 406928 |
Links to iHOP | 406928 |
|
Sequence Information |
|
Nucleotide Sequence |
>406928 : length: 23 ttattgcttaagaatacgcgtag |