Entrez Gene

Basic Information
Gene ID	406935
Name	MIR143
Synonym	MIRN143;microRNA 143;MIR143;microRNA 143
Definition	-
Position	5q32
Gene Type	miscRNA
Source	Count: 2; Pubmed_search,Generif
Literature support	Count: 3 PubMed records as below.
Evidence Status	Description
reviewed	Small RNA sequencing and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma.
reviewed	findings suggest that the chemically-modified synthetic miR-143 functions as a tumor suppressor in T24 cells by targeting ERK5 and/or Akt.
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
	More detail of all 3 literatures about MIR143
External Links
Links to Entrez Gene	406935
Links to all GeneRIF Items	406935
Links to iHOP	406935
Sequence Information
Nucleotide Sequence	>406935 : length: 22 ggtgcagtgctgcatctctggt