Entrez Gene

Basic Information
Gene ID	406937
Name	MIR145
Synonym	MIRN145\|miR-145\|miRNA145;microRNA 145;MIR145;microRNA 145
Definition	-
Position	5q32
Gene Type	miscRNA
Source	Count: 1; Generif
Literature support	Count: 2 PubMed records as below.
Evidence Status	Description
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	"Data show that IGF-IR resistant to miR145 is not down-regulated by miR145 but fails to rescue colon cancer cells from growth inhibition, and indicate that down-regulation of IRS-1 plays a significant role in the tumor suppressor activity of miR145."
	More detail of all 2 literatures about MIR145
External Links
Links to Entrez Gene	406937
Links to all GeneRIF Items	406937
Links to iHOP	406937
Sequence Information
Nucleotide Sequence	>406937 : length: 23 gtccagttttcccaggaatccct