Entrez Gene

Basic Information
Gene ID	406948
Name	MIR15A
Synonym	MIRN15A\|hsa-mir-15a\|miRNA15A;microRNA 15a;MIR15A;microRNA 15a
Definition	-
Position	13q14.2
Gene Type	miscRNA
Source	Count: 2; Pubmed_search,Generif
Literature support	Count: 4 PubMed records as below.
Evidence Status	Description
reviewed	"tumor suppressors, miR-15a are homozygously deleted in a subset of prostate cancers."
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	MicroRNAs (miRNAs) encoded by the miR-15/16 cluster are known to act as tumor suppressors.
reviewed	c-Myb oncoprotein is an essential target of the dleu2 tumor suppressor microRNA cluster.
	More detail of all 4 literatures about MIR15A
External Links
Links to Entrez Gene	406948
Links to all GeneRIF Items	406948
Links to iHOP	406948
Sequence Information
Nucleotide Sequence	>406948 : length: 22 tagcagcacataatggtttgtg