Entrez Gene

Basic Information
Gene ID	406950
Name	MIR16-1
Synonym	MIRN16-1\|miRNA16-1;microRNA 16-1;MIR16-1;microRNA 16-1
Definition	-
Position	13q14.2
Gene Type	miscRNA
Source	Count: 2; Pubmed_search,Generif
Literature support	Count: 3 PubMed records as below.
Evidence Status	Description
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	MicroRNAs (miRNAs) encoded by the miR-15/16 cluster are known to act as tumor suppressors.
reviewed	c-Myb oncoprotein is an essential target of the dleu2 tumor suppressor microRNA cluster.
	More detail of all 3 literatures about MIR16-1
External Links
Links to Entrez Gene	406950
Links to all GeneRIF Items	406950
Links to iHOP	406950
Sequence Information
Nucleotide Sequence	>406950 : length: 22 tagcagcacgtaaatattggcg