|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406952 |
Name | MIR17 |
Synonym | MIR17-5p|MIR91|MIRN17|MIRN91|hsa-mir-17|miR-17|miR17-3p|miRNA17|miRNA91;microRNA 17;MIR17;microRNA 17 |
Definition | - |
Position | 13q31.3 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | "findings show miR-17-5p acts specifically at the G1/S-phase cell cycle boundary, by targeting more than 20 genes involved in transition between these phases; miR-17-5p is able to act as both an oncogene & tumor suppressor in different cellular contexts". |
| More detail of all 1 literatures about MIR17 | |
|
External Links |
|
Links to Entrez Gene | 406952 |
Links to all GeneRIF Items | 406952 |
Links to iHOP | 406952 |
|
Sequence Information |
|
Nucleotide Sequence |
>406952 : length: 23 caaagtgcttacagtgcaggtag |