|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406953 |
Name | MIR18A |
Synonym | MIR18|MIRN18|MIRN18A|hsa-mir-18|hsa-mir-18a|miR-18|miRNA18A;microRNA 18a;MIR18A;microRNA 18a |
Definition | - |
Position | 13q31.3 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
potential | "miR-18a* may function as a tumor suppressor by targeting on K-Ras. Therefore, the miRNA may also be a potential therapeutic agent or target for cancer therapy." |
| More detail of all 1 literatures about MIR18A | |
|
External Links |
|
Links to Entrez Gene | 406953 |
Links to all GeneRIF Items | 406953 |
Links to iHOP | 406953 |
|
Sequence Information |
|
Nucleotide Sequence |
>406953 : length: 23 taaggtgcatctagtgcagatag |