|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406961 |
Name | MIR185 |
Synonym | MIRN185|miR-185;microRNA 185;MIR185;microRNA 185 |
Definition | - |
Position | 22q11.21 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | Altered expression of the novel tumor suppressor miR-185 may be one of the central events that leads to dysregulation of oncogenic protein Six1 in human cancers. |
| More detail of all 1 literatures about MIR185 | |
|
External Links |
|
Links to Entrez Gene | 406961 |
Links to all GeneRIF Items | 406961 |
Links to iHOP | 406961 |
|
Sequence Information |
|
Nucleotide Sequence |
>406961 : length: 22 tggagagaaaggcagttcctga |