|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 406961 |
Name | MIR185 |
Synonym | MIRN185|miR-185;microRNA 185;MIR185;microRNA 185 |
Definition | - |
Position | 22q11.21 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
Evidence Status | Description |
reviewed | Altered expression of the novel tumor suppressor miR-185 may be one of the central events that leads to dysregulation of oncogenic protein Six1 in human cancers. |
| More detail of all 1 literatures about MIR185 | |
External Links | |
Links to Entrez Gene | 406961 |
Links to all GeneRIF Items | 406961 |
Links to iHOP | 406961 |
Sequence Information | |
Nucleotide Sequence | >406961 : length: 22 tggagagaaaggcagttcctga |
|
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |