|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 406967 |
Name | MIR192 |
Synonym | MIRN192|miR-192|miRNA192;microRNA 192;MIR192;microRNA 192 |
Definition | - |
Position | 11q13.1 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
Evidence Status | Description |
reviewed | Results showing a role for miR-192/215 in cell proliferation combined with recent observations that these miRNAs are underexpressed in primary cancers support the idea that miR-192 and miR-215 function as tumor suppressors. |
| More detail of all 1 literatures about MIR192 | |
External Links | |
Links to Entrez Gene | 406967 |
Links to all GeneRIF Items | 406967 |
Links to iHOP | 406967 |
Sequence Information | |
Nucleotide Sequence | >406967 : length: 21 ctgacctatgaattgacagcc |
|
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |