|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 406983 |
Name | MIR200A |
Synonym | MIRN200A;microRNA 200a;MIR200A;microRNA 200a |
Definition | - |
Position | 1p36.33 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 2 PubMed records as below. |
Evidence Status | Description |
potential | "This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets." |
reviewed | miR-200a appears to act as a multifunctional tumor suppressor miRNA in meningiomas through effects on the E-cadherin and Wnt/beta-catenin signaling pathways. |
| More detail of all 2 literatures about MIR200A | |
External Links | |
Links to Entrez Gene | 406983 |
Links to all GeneRIF Items | 406983 |
Links to iHOP | 406983 |
Sequence Information | |
Nucleotide Sequence | >406983 : length: 22 catcttaccggacagtgctgga |
|
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |