|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406986 |
Name | MIR203 |
Synonym | MIRN203|miR-203|miRNA203;microRNA 203;MIR203;microRNA 203 |
Definition | - |
Position | 14q32.33 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
potential | "Expression of miR-203 reduces ABL1 and BCR-ABL1 fusion protein levels and inhibits tumor cell proliferation in an ABL1-dependent manner, suggesting it may function as a tumor suppressor." |
| More detail of all 1 literatures about MIR203 | |
|
External Links |
|
Links to Entrez Gene | 406986 |
Links to all GeneRIF Items | 406986 |
Links to iHOP | 406986 |
|
Sequence Information |
|
Nucleotide Sequence |
>406986 : length: 22 gtgaaatgtttaggaccactag |