|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406989 |
Name | MIR206 |
Synonym | MIRN206|miRNA206;microRNA 206;MIR206;microRNA 206 |
Definition | - |
Position | 6p12.2 |
Gene Type | miscRNA |
Source | Count: 2; Pubmed_search,Generif |
Literature support | Count: 3 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | Expression of the tumor suppressor miR-206 is associated with cellular proliferative inhibition and impairs invasion in ERĪ±-positive endometrioid adenocarcinoma. |
reviewed | "Studies indicate that loss of tumor suppressor miR-206, and the overexpression of oncogenic miR-21 have been observed in many breast cancers." |
reviewed | miR-1/206 suppressed c-Met expression in rhabdomyosarcoma and could function as a potent tumor suppressor in c-Met-overexpressing tumors. |
| More detail of all 3 literatures about MIR206 | |
|
External Links |
|
Links to Entrez Gene | 406989 |
Links to all GeneRIF Items | 406989 |
Links to iHOP | 406989 |
|
Sequence Information |
|
Nucleotide Sequence |
>406989 : length: 22 tggaatgtaaggaagtgtgtgg |