|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406997 |
Name | MIR215 |
Synonym | MIRN215|miRNA215|mir-215;microRNA 215;MIR215;microRNA 215 |
Definition | - |
Position | 1q41 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | Results showing a role for miR-192/215 in cell proliferation combined with recent observations that these miRNAs are underexpressed in primary cancers support the idea that miR-192 and miR-215 function as tumor suppressors. |
| More detail of all 1 literatures about MIR215 | |
|
External Links |
|
Links to Entrez Gene | 406997 |
Links to all GeneRIF Items | 406997 |
Links to iHOP | 406997 |
|
Sequence Information |
|
Nucleotide Sequence |
>406997 : length: 21 atgacctatgaattgacagac |