|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 406999 |
Name | MIR217 |
Synonym | MIRN217|mir-217;microRNA 217;MIR217;microRNA 217 |
Definition | - |
Position | 2p16.1 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | frequently downregulated miR-217 can regulate KRAS and function as a tumor suppressor in pancreatic ductal adenocarcinoma (PDAC). |
| More detail of all 1 literatures about MIR217 | |
|
External Links |
|
Links to Entrez Gene | 406999 |
Links to all GeneRIF Items | 406999 |
Links to iHOP | 406999 |
|
Sequence Information |
|
Nucleotide Sequence |
>406999 : length: 23 tactgcatcaggaactgattgga |