|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407000 |
Name | MIR218-1 |
Synonym | MIRN218-1|mir-218-1;microRNA 218-1;MIR218-1;microRNA 218-1 |
Definition | - |
Position | 4p15.31 |
Gene Type | miscRNA |
Source | Count: 2; Pubmed_search,Generif |
Literature support | Count: 2 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | miR-218 on the genomic loss region of chromosome 4p15.31 functions as a tumor suppressor in bladder cancer. |
potential | "miR-218 expression is reduced in gastric cancer, and may function as a tumor suppressor." |
| More detail of all 2 literatures about MIR218-1 | |
|
External Links |
|
Links to Entrez Gene | 407000 |
Links to all GeneRIF Items | 407000 |
Links to iHOP | 407000 |
|
Sequence Information |
|
Nucleotide Sequence |
>407000 : length: 21 ttgtgcttgatctaaccatgt |