|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407004 |
Name | MIR22 |
Synonym | MIRN22|hsa-mir-22|miR-22;microRNA 22;MIR22;microRNA 22 |
Definition | - |
Position | 17p13.3 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 2 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | this study provides the first evidence that miR-22 restores the cellular senescence program in cancer cells and acts as a tumor suppressor. |
reviewed | miR-22 acts as a tumor suppressor through direct repression of MYCBP expression and subsequent reduction of oncogenic c-Myc activities. |
| More detail of all 2 literatures about MIR22 | |
|
External Links |
|
Links to Entrez Gene | 407004 |
Links to all GeneRIF Items | 407004 |
Links to iHOP | 407004 |
|
Sequence Information |
|
Nucleotide Sequence |
>407004 : length: 22 agttcttcagtggcaagcttta |