|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 407017 |
Name | MIR26B |
Synonym | MIRN26B|hsa-mir-26b|miR-26b;microRNA 26b;MIR26B;microRNA 26b |
Definition | - |
Position | 2q35 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 2 PubMed records as below. |
Evidence Status | Description |
reviewed | miR-26b may act as a tumor suppressor in glioma and it directly regulates EphA2 expression. |
potential | "This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets." |
| More detail of all 2 literatures about MIR26B | |
External Links | |
Links to Entrez Gene | 407017 |
Links to all GeneRIF Items | 407017 |
Links to iHOP | 407017 |
Sequence Information | |
Nucleotide Sequence | >407017 : length: 21 ttcaagtaattcaggataggt |
|
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |