|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407024 |
Name | MIR29B1 |
Synonym | MIRN29B1|miRNA29B1;microRNA 29b-1;MIR29B1;microRNA 29b-1 |
Definition | - |
Position | 7q32.3 |
Gene Type | miscRNA |
Source | Count: 2; Pubmed_search,Generif |
Literature support | Count: 2 PubMed records as below. |
|
Evidence Status |
Description |
potential | These findings suggest that miRNA-29b may play an important role in MM as a tumor suppressor. |
reviewed | MicroRNA-29b induces global DNA hypomethylation and tumor suppressor gene reexpression in acute myeloid leukemia by targeting directly DNMT3A and 3B and indirectly DNMT1. |
| More detail of all 2 literatures about MIR29B1 | |
|
External Links |
|
Links to Entrez Gene | 407024 |
Links to all GeneRIF Items | 407024 |
Links to iHOP | 407024 |
|
Sequence Information |
|
Nucleotide Sequence |
>407024 : length: 24 gctggtttcatatggtggtttaga |