Entrez Gene

General information | Expression | Regulation | Mutation | Interaction

Basic Information
Gene ID	407040
Name	MIR34A
Synonym	MIRN34A\|miRNA34A\|mir-34;microRNA 34a;MIR34A;microRNA 34a
Definition	-
Position	1p36.22\|1p36.22
Gene Type	miscRNA
Source	Count: 2; Pubmed_search,Generif
Literature support	Count: 10 PubMed records as below.
Evidence Status	Description
reviewed	Capture of microRNA-bound mRNAs identifies the tumor suppressor miR-34a as a regulator of growth factor signaling.
reviewed	MicroRNA-34a is a potent tumor suppressor molecule in vivo in neuroblastoma.
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	"Results demonstrate that miR-34a acts as a tumor suppressor in p53-mutant glioma cells U251, partially through regulating SIRT1."
reviewed	miR-34a is a tumor suppressor.
potential	miR-34a functions as a tumor suppressor in RB cells and is a potential therapeutic target.
reviewed	"miR-34a functions as a tumor suppressor, in part, through a SIRT1-p53 pathway".
reviewed	miR-34a represents a tumor suppressor gene which is inactivated by CpG methylation and subsequent transcriptional silencing in a broad range of tumors.
reviewed	miR-34a is a tumor suppressor gene in human neuroblastoma.
potential	MicroRNA-34a functions as a potential tumor suppressor by inducing apoptosis in neuroblastoma cells.
	More detail of all 10 literatures about MIR34A
External Links
Links to Entrez Gene	407040
Links to all GeneRIF Items	407040
Links to iHOP	407040
Sequence Information
Nucleotide Sequence	>407040 : length: 22 tggcagtgtcttagctggttgt