Entrez Gene

Basic Information
Gene ID	407041
Name	MIR34B
Synonym	MIRN34B\|miRNA34B;microRNA 34b;MIR34B;microRNA 34b
Definition	-
Position	11q23.1
Gene Type	miscRNA
Source	Count: 1; Generif
Literature support	Count: 2 PubMed records as below.
Evidence Status	Description
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	"miR-34b/c and BTG4 are novel tumor suppressors in colorectal cancer (CRC) and that the miR-34b/c CpG island, which bidirectionally regulates miR-34b/c and BTG4, is a frequent target of epigenetic silencing in CRC".
	More detail of all 2 literatures about MIR34B
External Links
Links to Entrez Gene	407041
Links to all GeneRIF Items	407041
Links to iHOP	407041
Sequence Information
Nucleotide Sequence	>407041 : length: 23 taggcagtgtcattagctgattg