Entrez Gene

Basic Information
Gene ID	407042
Name	MIR34C
Synonym	MIRN34C\|miRNA34C;microRNA 34c;MIR34C;microRNA 34c
Definition	-
Position	11q23.1
Gene Type	miscRNA
Source	Count: 1; Generif
Literature support	Count: 3 PubMed records as below.
Evidence Status	Description
reviewed	These results suggest differential tumor suppressor roles for miR-34c-3p and miR-34c-5p and provide new insights in the understanding of miRNA biology.
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	"miR-34b/c and BTG4 are novel tumor suppressors in colorectal cancer (CRC) and that the miR-34b/c CpG island, which bidirectionally regulates miR-34b/c and BTG4, is a frequent target of epigenetic silencing in CRC".
	More detail of all 3 literatures about MIR34C
External Links
Links to Entrez Gene	407042
Links to all GeneRIF Items	407042
Links to iHOP	407042
Sequence Information
Nucleotide Sequence	>407042 : length: 23 aggcagtgtagttagctgattgc