|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 407043 |
Name | MIR7-1 |
Synonym | MIRN7-1|hsa-mir-7-1|mir-7-1;microRNA 7-1;MIR7-1;microRNA 7-1 |
Definition | - |
Position | 9q21.32 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
potential | microRNA-7 (miR-7) is a potential tumor suppressor in glioblastoma targeting critical cancer pathways. |
| More detail of all 1 literatures about MIR7-1 | |
|
External Links |
|
Links to Entrez Gene | 407043 |
Links to all GeneRIF Items | 407043 |
Links to iHOP | 407043 |
|
Sequence Information |
|
Nucleotide Sequence |
>407043 : length: 23 tggaagactagtgattttgttgt |