|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 442892 |
Name | MIR148B |
Synonym | MIRN148B|mir-148b;microRNA 148b;MIR148B;microRNA 148b |
Definition | - |
Position | 12q13.13 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | miR-148b acts as a tumor suppressor in gastric cancer. |
| More detail of all 1 literatures about MIR148B | |
|
External Links |
|
Links to Entrez Gene | 442892 |
Links to all GeneRIF Items | 442892 |
Links to iHOP | 442892 |
|
Sequence Information |
|
Nucleotide Sequence |
>442892 : length: 22 aagttctgttatacactcaggc |