|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 442904 |
Name | MIR335 |
Synonym | MIRN335|hsa-mir-335|miRNA335;microRNA 335;MIR335;microRNA 335 |
Definition | - |
Position | 7q32.2 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
potential | implicate the miR-335 locus on 7q32.2 as the first selective metastasis suppressor and tumor initiation suppressor locus in human breast cancer. |
| More detail of all 1 literatures about MIR335 | |
|
External Links |
|
Links to Entrez Gene | 442904 |
Links to all GeneRIF Items | 442904 |
Links to iHOP | 442904 |
|
Sequence Information |
|
Nucleotide Sequence |
>442904 : length: 23 tcaagagcaataacgaaaaatgt |