|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 442920 |
Name | MIR196B |
Synonym | MIRN196B|miR-196b|miRNA196B;microRNA 196b;MIR196B;microRNA 196b |
Definition | - |
Position | 7p15.2 |
Gene Type | miscRNA |
Source | Count: 2; Pubmed_search,Generif |
Literature support | Count: 2 PubMed records as below. |
Evidence Status | Description |
reviewed | Functional genomics of tumor suppressor miR-196b in T-cell acute lymphoblastic leukemia. |
reviewed | Suggest that miR-196b functions as a tumor suppressor in B-cell lineage acute lymphoblastic leukemia. |
| More detail of all 2 literatures about MIR196B | |
External Links | |
Links to Entrez Gene | 442920 |
Links to all GeneRIF Items | 442920 |
Links to iHOP | 442920 |
Sequence Information | |
Nucleotide Sequence | >442920 : length: 22 taggtagtttcctgttgttggg |