|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 494324 |
Name | MIR375 |
Synonym | MIRN375|hsa-mir-375|miRNA375;microRNA 375;MIR375;microRNA 375 |
Definition | - |
Position | 2q35 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
potential | "miR-375 may function as a tumor suppressor to regulate gastric cancer cell proliferation potentially by targeting the JAK2 oncogene, implicating a role of miR-375 in the pathogenesis of gastric cancer". |
| More detail of all 1 literatures about MIR375 | |
|
External Links |
|
Links to Entrez Gene | 494324 |
Links to all GeneRIF Items | 494324 |
Links to iHOP | 494324 |
|
Sequence Information |
|
Nucleotide Sequence |
>494324 : length: 22 tttgttcgttcggctcgcgtga |