|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
Basic Information | |
|---|---|
Gene ID | 554213 |
Name | MIR449A |
Synonym | MIRN449|MIRN449A|hsa-mir-449;microRNA 449a;MIR449A;microRNA 449a |
Definition | - |
Position | 5q11.2 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 2 PubMed records as below. |
Evidence Status | Description |
reviewed | "Data indicate that miR-449a is a miRNA component of the Rb pathway and its tumor suppressor-like effects, in part, depends on Rb status in prostate cancer cells." |
reviewed | "reveals a tumor suppressor function of miR-449a/b through regulating Rb/E2F1 activity, and suggests that escape from this regulation through an aberrant epigenetic event contributes to E2F1 deregulation and unrestricted proliferation in human cancer". |
| More detail of all 2 literatures about MIR449A | |
External Links | |
Links to Entrez Gene | 554213 |
Links to all GeneRIF Items | 554213 |
Links to iHOP | 554213 |
Sequence Information | |
Nucleotide Sequence | >554213 : length: 22 tggcagtgtattgttagctggt |
|
Copyright © 2016-Present - The Univsersity of Texas Health Science Center at Houston Rights Reserved |