Entrez Gene

Basic Information
Gene ID	574411
Name	MIR451A
Synonym	MIR451\|MIRN451\|hsa-mir-451;microRNA 451a;MIR451A;microRNA 451a
Definition	-
Position	17q11.2
Gene Type	miscRNA
Source	Count: 2; Pubmed_search,Generif
Literature support	Count: 4 PubMed records as below.
Evidence Status	Description
reviewed	Repression of tumor suppressor miR-451 is essential for NOTCH1-induced oncogenesis in T-ALL.
reviewed	MicroRNA-451 functions as a tumor suppressor in human non-small cell lung cancer by targeting ras-related protein 14 (RAB14).
potential	"This study, we performed a comprehensive analysis of putative human miRNA oncogenes and tumor suppressors. We found that miRNA oncogenes and tumor suppressors clearly show different patterns in function, evolutionary rate, expression, chromosome distribution, molecule size, free energy, transcription factors, and targets."
reviewed	MiRNA-451 plays a role as tumor suppressor in human glioma cells.
	More detail of all 4 literatures about MIR451A
External Links
Links to Entrez Gene	574411
Links to all GeneRIF Items	574411
Links to iHOP	574411
Sequence Information
Nucleotide Sequence	>574411 : length: 22 aaaccgttaccattactgagtt