|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 574455 |
Name | MIR193B |
Synonym | MIRN193B;microRNA 193b;MIR193B;microRNA 193b |
Definition | - |
Position | 16p13.12 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
potential | data suggest that miR-193b is an epigenetically silenced putative tumor suppressor in prostate cancer. |
| More detail of all 1 literatures about MIR193B | |
|
External Links |
|
Links to Entrez Gene | 574455 |
Links to all GeneRIF Items | 574455 |
Links to iHOP | 574455 |
|
Sequence Information |
|
Nucleotide Sequence |
>574455 : length: 22 cggggttttgagggcgagatga |