|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 574479 |
Name | MIR517A |
Synonym | MIRN517A;microRNA 517a;MIR517A;microRNA 517a |
Definition | - |
Position | 19q13.42 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 1 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | miR-517a functions as a tumor suppressor through inhibition of cell proliferation and induction of apoptosis in bladder cancer cells. |
| More detail of all 1 literatures about MIR517A | |
|
External Links |
|
Links to Entrez Gene | 574479 |
Links to all GeneRIF Items | 574479 |
Links to iHOP | 574479 |
|
Sequence Information |
|
Nucleotide Sequence |
>574479 : length: 22 cctctagatggaagcactgtct |