|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 60674 |
Name | GAS5 |
Synonym | NCRNA00030|SNHG2;growth arrest-specific 5 (non-protein coding);GAS5;growth arrest-specific 5 (non-protein coding) |
Definition | - |
Position | 1q25.1 |
Gene Type | miscRNA |
Source | Count: 1; Pubmed_search |
Literature support | Count: 3 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | Noncoding RNA gas5 is a growth arrest- and starvation-associated repressor of the glucocorticoid receptor. |
reviewed | "GAS5, a non-protein-coding RNA, controls apoptosis and is downregulated in breast cancer." |
reviewed | "In this review, author summarized the gene as tumor suppressor in table 2." |
| More detail of all 3 literatures about GAS5 | |
|
External Links |
|
Links to Entrez Gene | 60674 |
Links to all GeneRIF Items | 60674 |
Links to iHOP | 60674 |
|
Sequence Information |
|
Nucleotide Sequence |
>60674 : length: 651 tttcgaggtaggagtcgactcctgtgaggtatggtgctgggtgcggatgcagtgtggctc tggatagcaccttatggacagttgtgtccccaaggaaggatgagaatagctactgaagtc ctaaagagcaagcctaactcaagccattggcacacaggcattagacagaaagctggaagt tgaaatggtggagtccaacttgcctggaccagcttaatggttctgctcctggtaacgttt ttatccatggatgacttgcttgggtaaggacatgaagacagttcctgtcataccttttaa aggtatggagagtcggcttgactacactgtgtggagcaagttttaaagaagcaaaggact cagaattcatgattgaagaaatgcaggcagacctgttatcctaaactagggtttttaatg accacaacaagcaagcatgcagcttactgcttgaaagggtcttgcctcacccaagctaga gtgcagtggcctttgaagcttactacagcctcaaacttctgggctcaagtgatcctcagc ctcccagtggtctttgtagactgcctgatggagtctcatggcacaagaagattaaaacag tgtctccaattttaataaatttttgcaatccaaaaaaaaaaaaaaaaaaaa |