|
|
||
|
|
||
| General information | Expression | Regulation | Mutation | Interaction |
|
Basic Information |
|
|---|---|
Gene ID | 693123 |
Name | MIR449B |
Synonym | MIRN449B;microRNA 449b;MIR449B;microRNA 449b |
Definition | - |
Position | 5q11.2 |
Gene Type | miscRNA |
Source | Count: 1; Generif |
Literature support | Count: 2 PubMed records as below. |
|
Evidence Status |
Description |
reviewed | "Enhanced NPM-retinoblastoma tumor suppressor protein (pRB) interaction, leading to the relief of the repressive pRB-E2F1 circuitry and the consequent transcriptional activation of E2F1 and several downstream DNA repair genes." |
reviewed | "reveals a tumor suppressor function of miR-449a/b through regulating Rb/E2F1 activity, and suggests that escape from this regulation through an aberrant epigenetic event contributes to E2F1 deregulation and unrestricted proliferation in human cancer". |
| More detail of all 2 literatures about MIR449B | |
|
External Links |
|
Links to Entrez Gene | 693123 |
Links to all GeneRIF Items | 693123 |
Links to iHOP | 693123 |
|
Sequence Information |
|
Nucleotide Sequence |
>693123 : length: 22 aggcagtgtattgttagctggc |