SZGR2

Summary ?

GeneID	10072
Symbol	DPP3
Synonyms	DPPIII
Description	dipeptidyl peptidase 3
Reference	MIM:606818\|HGNC:HGNC:3008\|Ensembl:ENSG00000254986\|HPRD:06012\|Vega:OTTHUMG00000167143
Gene type	protein-coding
Map location	11q13.2
Pascal p-value	0.007
Sherlock p-value	0.453
Fetal beta	0.886
DMG	1 (# studies)
eGene	Myers' cis & trans
Support	Ascano FMRP targets

Gene in Data Sources

Gene set name	Method of gene set	Description	Info
CV:PGCnp	Genome-wide Association Study	GWAS
DMG:vanEijk_2014	Genome-wide DNA methylation analysis	This dataset includes 432 differentially methylated CpG sites corresponding to 391 unique transcripts between schizophrenia patients (n=260) and unaffected controls (n=250).	1
Expression	Meta-analysis of gene expression	P value: 1.547

Section I. Genetics and epigenetics annotation

Differentially methylated gene

Probe	Chromosome	Position	Nearest gene	P (dis)	Beta (dis)	FDR (dis)	Study
cg20808145	11	66025705	DPP3	2.698E-4	3.407		DMG:vanEijk_2014

eQTL annotation

SNP ID	Chromosome	Position	eGene	Gene Entrez ID	qvalue	eQTL type
rs12296921	chr12	60406485	DPP3	10072	0.17	trans
rs8045342	chr16	55138037	DPP3	10072	0.1	trans
rs4783875	chr16	55143190	DPP3	10072	0.19	trans

Section II. Transcriptome annotation

General gene expression (GTEx)

Gene expression during devlopment (BrainCloud)

Footnote:
A total of 269 time points ploted, with n=38 fetal samples (x=1:38). Each triangle represents one time point.

Gene expression of temporal and spatial changes (BrainSpan)

Footnote:
SC: sub-cortical regions; SM: sensory-motor regions; FC: frontal cortex; and TP: temporal-parietal cortex
ST1: fetal (13 - 26 postconception weeks), ST2: early infancy to late childhood (4 months to 11 years), and ST3: adolescence to adulthood (13 - 23 years)
The bar shown representes the lower 25% and upper 25% of the expression distribution.

Top co-expressed genes in brain regions

Top 10 positively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
MEGF11	0.47	0.26
AC079210.1	0.47	0.22
CARD11	0.45	0.29
GNG13	0.45	0.34
SMPX	0.44	0.31
ADCY8	0.44	0.24
CCDC136	0.43	0.23
SUSD2	0.43	0.30
CASQ2	0.43	0.24
AL133445.2	0.42	0.22

Top 10 negatively co-expressed genes
Gene	Pearson's Correlation	Spearman's Correlation
RPL31	-0.23	-0.32
C6orf48	-0.22	-0.25
AC008073.1	-0.21	-0.25
FTHL16	-0.21	-0.21
FAM128A	-0.21	-0.25
GTF3C6	-0.21	-0.24
RPS20	-0.20	-0.30
RPL17P20	-0.20	-0.23
RPL34	-0.20	-0.26
RPS24	-0.20	-0.28

Section III. Gene Ontology annotation

Molecular function	GO term	Evidence	Neuro keywords	PubMed ID
GO:0004177	aminopeptidase activity	IEA		-
GO:0008270	zinc ion binding	IEA		-
GO:0008239	dipeptidyl-peptidase activity	TAS		10387075
GO:0008237	metallopeptidase activity	IEA		-
GO:0008233	peptidase activity	IEA		-
GO:0046872	metal ion binding	IEA		-
Biological process	GO term	Evidence	Neuro keywords	PubMed ID
GO:0006508	proteolysis	TAS		10387075
Cellular component	GO term	Evidence	Neuro keywords	PubMed ID
GO:0005737	cytoplasm	IEA		-

Section V. Pathway annotation

Pathway name	Pathway size	# SZGR 2.0 genes in pathway	Info
DIAZ CHRONIC MEYLOGENOUS LEUKEMIA UP	1382	904	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER ADVANCED VS EARLY DN	138	70	All SZGR 2.0 genes in this pathway
VECCHI GASTRIC CANCER EARLY UP	430	232	All SZGR 2.0 genes in this pathway
TIEN INTESTINE PROBIOTICS 24HR UP	557	331	All SZGR 2.0 genes in this pathway
ENK UV RESPONSE EPIDERMIS UP	293	179	All SZGR 2.0 genes in this pathway
ROSTY CERVICAL CANCER PROLIFERATION CLUSTER	140	73	All SZGR 2.0 genes in this pathway
MOHANKUMAR TLX1 TARGETS UP	414	287	All SZGR 2.0 genes in this pathway
LOCKWOOD AMPLIFIED IN LUNG CANCER	214	139	All SZGR 2.0 genes in this pathway
LIAO METASTASIS	539	324	All SZGR 2.0 genes in this pathway
BENPORATH SOX2 TARGETS	734	436	All SZGR 2.0 genes in this pathway
NIKOLSKY BREAST CANCER 11Q12 Q14 AMPLICON	158	93	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY NO BLOOD UP	222	139	All SZGR 2.0 genes in this pathway
RODWELL AGING KIDNEY UP	487	303	All SZGR 2.0 genes in this pathway
IWANAGA CARCINOGENESIS BY KRAS PTEN DN	353	226	All SZGR 2.0 genes in this pathway
RIZKI TUMOR INVASIVENESS 2D UP	69	46	All SZGR 2.0 genes in this pathway
WEST ADRENOCORTICAL TUMOR UP	294	199	All SZGR 2.0 genes in this pathway
WANG TUMOR INVASIVENESS UP	374	247	All SZGR 2.0 genes in this pathway
WONG EMBRYONIC STEM CELL CORE	335	193	All SZGR 2.0 genes in this pathway
YAO TEMPORAL RESPONSE TO PROGESTERONE CLUSTER 17	181	101	All SZGR 2.0 genes in this pathway
WAKABAYASHI ADIPOGENESIS PPARG RXRA BOUND 8D	882	506	All SZGR 2.0 genes in this pathway
VANOEVELEN MYOGENESIS SIN3A TARGETS	220	133	All SZGR 2.0 genes in this pathway

Section VI. microRNA annotation

miRNA family	Target position			miRNA ID	miRNA seq
miRNA family	UTR start	UTR end	Match method	miRNA ID	miRNA seq
let-7/98	116	123	1A,m8	hsa-let-7a^brain	UGAGGUAGUAGGUUGUAUAGUU
				hsa-let-7b^brain	UGAGGUAGUAGGUUGUGUGGUU
				hsa-let-7c^brain	UGAGGUAGUAGGUUGUAUGGUU
				hsa-let-7d^brain	AGAGGUAGUAGGUUGCAUAGU
				hsa-let-7e^brain	UGAGGUAGGAGGUUGUAUAGU
				hsa-let-7f^brain	UGAGGUAGUAGAUUGUAUAGUU
				hsa-miR-98^brain	UGAGGUAGUAAGUUGUAUUGUU
				hsa-let-7g^SZ	UGAGGUAGUAGUUUGUACAGU
				hsa-let-7i^brain	UGAGGUAGUAGUUUGUGCUGU
miR-148/152	207	213	m8	hsa-miR-148a	UCAGUGCACUACAGAACUUUGU
				hsa-miR-152^brain	UCAGUGCAUGACAGAACUUGGG
				hsa-miR-148b	UCAGUGCAUCACAGAACUUUGU
miR-34/449	209	216	1A,m8	hsa-miR-34a^brain	UGGCAGUGUCUUAGCUGGUUGUU
				hsa-miR-34c	AGGCAGUGUAGUUAGCUGAUUGC
				hsa-miR-449	UGGCAGUGUAUUGUUAGCUGGU
				hsa-miR-449b	AGGCAGUGUAUUGUUAGCUGGC

SZ: miRNAs which differentially expressed in brain cortex of schizophrenia patients comparing with control samples using microarray. Click here to see the list of SZ related miRNAs.
Brain: miRNAs which are expressed in brain based on miRNA microarray expression studies. Click here to see the list of brain related miRNAs.

Gene Page: DPP3